Aktualizacja notatnika

wyk/02_Jezyki.org

@@ -9,7 +9,7 @@ Używać będziemy generatorów.
 
 *Pytanie* Dlaczego generatory zamiast list?
 
-#+BEGIN_SRC python :session mysession :exports both :results raw drawer
+#+BEGIN_SRC ipython :session mysession :exports both :results raw drawer
   import requests
 
   url = 'https://wolnelektury.pl/media/book/txt/pan-tadeusz.txt'
@@ -31,7 +31,7 @@ Powrót pani
 
 *** Znaki
 
-#+BEGIN_SRC python :session mysession :exports both :results raw drawer
+#+BEGIN_SRC ipython :session mysession :exports both :results raw drawer
   from itertools import islice
 
   def get_characters(t):
@@ -45,7 +45,7 @@ Powrót pani
 ['K', 's', 'i', 'ę', 'g', 'a', ' ', 'p', 'i', 'e', 'r', 'w', 's', 'z', 'a', '\r', '\n', '\r', '\n', '\r', '\n', '\r', '\n', 'G', 'o', 's', 'p', 'o', 'd', 'a', 'r', 's', 't', 'w', 'o', '\r', '\n', '\r', '\n', 'P', 'o', 'w', 'r', 'ó', 't', ' ', 'p', 'a', 'n', 'i']
 :end:
 
-#+BEGIN_SRC python :session mysession :exports both :results raw drawer
+#+BEGIN_SRC ipython :session mysession :exports both :results raw drawer
   from collections import Counter
 
   c = Counter(get_characters(pan_tadeusz))
@@ -65,7 +65,7 @@ Napiszmy pomocniczą funkcję, która zwraca *listę frekwencyjną*.
 Counter({' ': 63444, 'a': 30979, 'i': 29353, 'e': 25343, 'o': 23050, 'z': 22741, 'n': 15505, 'r': 15328, 's': 15255, 'w': 14625, 'c': 14153, 'y': 13732, 'k': 12362, 'd': 11465, '\r': 10851, '\n': 10851, 't': 10757, 'm': 10269, 'ł': 10059, ',': 9130, 'p': 8031, 'u': 7699, 'l': 6677, 'j': 6586, 'b': 5753, 'ę': 5534, 'ą': 4794, 'g': 4775, 'h': 3915, 'ż': 3334, 'ó': 3097, 'ś': 2524, '.': 2380, 'ć': 1956, ';': 1445, 'P': 1265, 'W': 1258, ':': 1152, '!': 1083, 'S': 1045, 'T': 971, 'I': 795, 'N': 793, 'Z': 785, 'J': 729, '—': 720, 'A': 698, 'K': 683, 'ń': 651, 'M': 585, 'B': 567, 'O': 567, 'C': 556, 'D': 552, '«': 540, '»': 538, 'R': 489, '?': 441, 'ź': 414, 'f': 386, 'G': 358, 'L': 316, 'H': 309, 'Ż': 219, 'U': 184, '…': 157, '*': 150, '(': 76, ')': 76, 'Ś': 71, 'F': 47, 'é': 43, '-': 33, 'Ł': 24, 'E': 23, '/': 19, 'Ó': 13, '8': 10, '9': 8, '2': 6, 'v': 5, 'Ź': 4, '1': 4, '3': 3, 'x': 3, 'V': 3, '7': 2, '4': 2, '5': 2, 'q': 2, 'æ': 2, 'à': 1, 'Ć': 1, '6': 1, '0': 1})
 :end:
 
-#+BEGIN_SRC python :session mysession :exports both :results raw drawer
+#+BEGIN_SRC ipython :session mysession :exports both :results raw drawer
   from collections import Counter
   from collections import OrderedDict
 
@@ -88,7 +88,7 @@ OrderedDict([(' ', 63444), ('a', 30979), ('i', 29353), ('e', 25343), ('o', 23050
 :end:
 
 
-#+BEGIN_SRC python :session mysession :results file
+#+BEGIN_SRC ipython :session mysession :results file
   import matplotlib.pyplot as plt
   from collections import OrderedDict
 
@@ -119,7 +119,7 @@ Co rozumiemy pod pojęciem słowa czy wyrazu, nie jest oczywiste. W praktyce zal
 Załóżmy, że przez wyraz rozumieć będziemy nieprzerwany ciąg liter bądź cyfr (oraz gwiazdek
 — to za chwilę ułatwi nam analizę pewnego tekstu…).
 
-#+BEGIN_SRC python :session mysession :exports both :results raw drawer
+#+BEGIN_SRC ipython :session mysession :exports both :results raw drawer
   from itertools import islice
   import regex as re
 
@@ -138,7 +138,7 @@ Załóżmy, że przez wyraz rozumieć będziemy nieprzerwany ciąg liter bądź
 Zobaczmy 20 najczęstszych wyrazów.
 
 
-#+BEGIN_SRC python :session mysession :results file
+#+BEGIN_SRC ipython :session mysession :results file
   rang_freq_with_labels('pt-words-20', get_words(pan_tadeusz), top=20)
 #+END_SRC
 
@@ -147,7 +147,7 @@ Zobaczmy 20 najczęstszych wyrazów.
 
 Zobaczmy pełny obraz, już bez etykiet.
 
-#+BEGIN_SRC python :session mysession :results file
+#+BEGIN_SRC ipython :session mysession :results file
   import matplotlib.pyplot as plt
   from math import log
 
@@ -172,7 +172,7 @@ Zobaczmy pełny obraz, już bez etykiet.
 Widać, jak różne skale obejmuje ten wykres. Zastosujemy logarytm,
 najpierw tylko do współrzędnej $y$.
 
-#+BEGIN_SRC python :session mysession :results file
+#+BEGIN_SRC ipython :session mysession :results file
   import matplotlib.pyplot as plt
   from math import log
 
@@ -222,7 +222,7 @@ logarytmicznej dla **obu** osi, otrzymamy kształt zbliżony do linii prostej.
 
 Tę własność tekstów nazywamy **prawem Zipfa**.
 
-#+BEGIN_SRC python :session mysession :results file
+#+BEGIN_SRC ipython :session mysession :results file
   import matplotlib.pyplot as plt
   from math import log
 
@@ -249,7 +249,7 @@ Tę własność tekstów nazywamy **prawem Zipfa**.
 Powiązane z prawem Zipfa prawo językowe opisuje zależność między
 częstością użycia słowa a jego długością. Generalnie im krótsze słowo, tym częstsze.
 
-#+BEGIN_SRC python :session mysession :results file
+#+BEGIN_SRC ipython :session mysession :results file
   def freq_vs_length(name, g, top=None):
       freq = freq_list(g)
 
@@ -294,7 +294,7 @@ po prostu na jednostkach, nie na ich podciągach.
 
 Statystyki, które policzyliśmy dla pojedynczych liter czy wyrazów, możemy powtórzyć dla n-gramów.
 
-#+BEGIN_SRC python :session mysession :exports both :results raw drawer
+#+BEGIN_SRC ipython :session mysession :exports both :results raw drawer
   def ngrams(iter, size):
     ngram = []
     for item in iter:
@@ -317,7 +317,7 @@ Zawsze powinniśmy się upewnić, czy jest jasne, czy chodzi o n-gramy znakowe c
 
 *** 3-gramy znakowe
 
-#+BEGIN_SRC python :session mysession :results file
+#+BEGIN_SRC ipython :session mysession :results file
   log_rang_log_freq('pt-3-char-ngrams-log-log', ngrams(get_characters(pan_tadeusz), 3))
 #+END_SRC
 
@@ -326,7 +326,7 @@ Zawsze powinniśmy się upewnić, czy jest jasne, czy chodzi o n-gramy znakowe c
 
 *** 2-gramy wyrazowe
 
-#+BEGIN_SRC python :session mysession :results file
+#+BEGIN_SRC ipython :session mysession :results file
   log_rang_log_freq('pt-2-word-ngrams-log-log', ngrams(get_words(pan_tadeusz), 2))
 #+END_SRC
 
@@ -348,7 +348,7 @@ transkrybować manuskrypt, pozostaje sprawą dyskusyjną, natomiast wybór
 takiego czy innego systemu transkrypcji nie powinien wpływać
 dramatycznie na analizę statystyczną.
 
-#+BEGIN_SRC python :session mysession :exports both :results raw drawer
+#+BEGIN_SRC ipython :session mysession :exports both :results raw drawer
   import requests
 
   voynich_url = 'http://www.voynich.net/reeds/gillogly/voynich.now'
@@ -370,28 +370,28 @@ dramatycznie na analizę statystyczną.
 9 OR 9FAM ZO8 QOAR9 Q*R 8ARAM 29 [O82*]OM OPCC9 OP
 :end:
 
-#+BEGIN_SRC python :session mysession :results file
+#+BEGIN_SRC ipython :session mysession :results file
   rang_freq_with_labels('voy-chars', get_characters(voynich))
 #+END_SRC
 
 #+RESULTS:
 [[file:02_Jezyki/voy-chars.png]]
 
-#+BEGIN_SRC python :session mysession :results file
+#+BEGIN_SRC ipython :session mysession :results file
   log_rang_log_freq('voy-log-log', get_words(voynich))
 #+END_SRC
 
 #+RESULTS:
 [[file:02_Jezyki/voy-log-log.png]]
 
-#+BEGIN_SRC python :session mysession :results file
+#+BEGIN_SRC ipython :session mysession :results file
   rang_freq_with_labels('voy-words-20', get_words(voynich), top=20)
 #+END_SRC
 
 #+RESULTS:
 [[file:02_Jezyki/voy-words-20.png]]
 
-#+BEGIN_SRC python :session mysession :results file
+#+BEGIN_SRC ipython :session mysession :results file
     log_rang_log_freq('voy-words-log-log', get_words(voynich))
 #+END_SRC
 
@@ -406,7 +406,7 @@ Podstawowe litery są tylko cztery, reprezentują one nukleotydy, z których zbu
 a, g, c, t.
 
 
-#+BEGIN_SRC python :session mysession :exports both :results raw drawer
+#+BEGIN_SRC ipython :session mysession :exports both :results raw drawer
   import requests
 
   dna_url = 'https://raw.githubusercontent.com/egreen18/NanO_GEM/master/rawGenome.txt'
@@ -423,7 +423,7 @@ a, g, c, t.
 TATAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTA
 :end:
 
-#+BEGIN_SRC python :session mysession :results file
+#+BEGIN_SRC ipython :session mysession :results file
   rang_freq_with_labels('dna-chars', get_characters(dna))
 #+END_SRC
 
@@ -436,7 +436,7 @@ Nukleotydy rzeczywiście są jak litery, same w sobie nie niosą
 znaczenia. Dopiero ciągi trzech nukleotydów, /tryplety/, kodują jeden
 z dwudziestu aminokwasów.
 
-#+BEGIN_SRC python :session mysession :results file
+#+BEGIN_SRC ipython :session mysession :results file
   genetic_code = {
        'ATA':'I', 'ATC':'I', 'ATT':'I', 'ATG':'M',
        'ACA':'T', 'ACC':'T', 'ACG':'T', 'ACT':'T',
@@ -472,7 +472,7 @@ Z aminokwasów zakodowanych przez tryplet budowane są białka.
 Maszyneria budująca białka czyta sekwencję aż do napotkania
 trypletu STOP (_ powyżej). Taka sekwencja to /gen/.
 
-#+BEGIN_SRC python :session mysession :results file
+#+BEGIN_SRC ipython :session mysession :results file
   def get_genes(triplets):
     gene = []
     for ammino in triplets: