PCQRSCANER/venv/Lib/site-packages/fuzzysearch-0.6.2.dist-info/METADATA
2019-12-22 21:51:47 +01:00

230 lines
7.2 KiB
Plaintext

Metadata-Version: 2.1
Name: fuzzysearch
Version: 0.6.2
Summary: fuzzysearch is useful for finding approximate subsequence matches
Home-page: https://github.com/taleinat/fuzzysearch
Author: Tal Einat
Author-email: taleinat@gmail.com
License: MIT
Keywords: fuzzysearch
Platform: UNKNOWN
Classifier: Development Status :: 3 - Alpha
Classifier: Intended Audience :: Developers
Classifier: License :: OSI Approved :: MIT License
Classifier: Natural Language :: English
Classifier: Operating System :: MacOS :: MacOS X
Classifier: Programming Language :: Python :: 2
Classifier: Programming Language :: Python :: 2.7
Classifier: Programming Language :: Python :: 3
Classifier: Programming Language :: Python :: 3.4
Classifier: Programming Language :: Python :: 3.5
Classifier: Programming Language :: Python :: 3.6
Classifier: Programming Language :: Python :: 3.7
Classifier: Programming Language :: Python :: Implementation :: CPython
Classifier: Topic :: Software Development :: Libraries :: Python Modules
Requires-Dist: six
===========
fuzzysearch
===========
.. image:: https://img.shields.io/pypi/v/fuzzysearch.svg?style=flat
:target: https://pypi.python.org/pypi/fuzzysearch
:alt: Latest Version
.. image:: https://img.shields.io/travis/taleinat/fuzzysearch.svg?branch=master
:target: https://travis-ci.org/taleinat/fuzzysearch/branches
:alt: Build & Tests Status
.. image:: https://img.shields.io/coveralls/taleinat/fuzzysearch.svg?branch=master
:target: https://coveralls.io/r/taleinat/fuzzysearch?branch=master
:alt: Test Coverage
.. image:: https://img.shields.io/pypi/dm/fuzzysearch.svg?style=flat
:target: https://pypi.python.org/pypi/fuzzysearch
:alt: Downloads
.. image:: https://img.shields.io/pypi/wheel/fuzzysearch.svg?style=flat
:target: https://pypi.python.org/pypi/fuzzysearch
:alt: Wheels
.. image:: https://img.shields.io/pypi/pyversions/fuzzysearch.svg?style=flat
:target: https://pypi.python.org/pypi/fuzzysearch
:alt: Supported Python versions
.. image:: https://img.shields.io/pypi/implementation/fuzzysearch.svg?style=flat
:target: https://pypi.python.org/pypi/fuzzysearch
:alt: Supported Python implementations
.. image:: https://img.shields.io/pypi/l/fuzzysearch.svg?style=flat
:target: https://pypi.python.org/pypi/fuzzysearch/
:alt: License
**Easy fuzzy search that just works, fast!**
.. code:: python
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1)
[Match(start=3, end=9, dist=1)]
* Approximate sub-string searches
* A single, simple function to use
* Chooses the fastest available search mechanism based on the given input
* Uses the Levenshtein Distance metric with configurable parameters
* Separately configure the max. allowed distance, substitutions, deletions
and insertions
* Advanced algorithms with optional C and Cython optimizations
* Extensively tested
* Free software: `MIT license <LICENSE>`_
For more info, see the `documentation <http://fuzzysearch.rtfd.org>`_.
Installation
------------
.. code::
$ pip install fuzzysearch
This will work even if installing the C and Cython extensions fails, using
pure-Python fallbacks.
Usage
-----
Just call ``find_near_matches()`` with the sub-sequence you're looking for,
the sequence to search, and the matching parameters:
.. code:: python
>>> from fuzzysearch import find_near_matches
# search for 'PATTERN' with a maximum Levenshtein Distance of 1
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1)
[Match(start=3, end=9, dist=1)]
.. code:: python
>>> sequence = '''\
GACTAGCACTGTAGGGATAACAATTTCACACAGGTGGACAATTACATTGAAAATCACAGATTGGTCACACACACA
TTGGACATACATAGAAACACACACACATACATTAGATACGAACATAGAAACACACATTAGACGCGTACATAGACA
CAAACACATTGACAGGCAGTTCAGATGATGACGCCCGACTGATACTCGCGTAGTCGTGGGAGGCAAGGCACACAG
GGGATAGG'''
>>> subsequence = 'TGCACTGTAGGGATAACAAT' # distance = 1
>>> find_near_matches(subsequence, sequence, max_l_dist=2)
[Match(start=3, end=24, dist=1)]
Matching Criteria
-----------------
The search function supports four possible match criteria, which may be
supplied in any combination:
* maximum Levenshtein distance (*max_l_dist*)
* maximum # of subsitutions
* maximum # of deletions ("delete" = skip a character in the sub-sequence)
* maximum # of insertions ("insert" = skip a character in the sequence)
Not supplying a criterion means that there is no limit for it. For this reason,
one must always supply *max_l_dist* and/or all other criteria.
.. code:: python
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1)
[Match(start=3, end=9, dist=1)]
# this will not match since max-deletions is set to zero
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1, max_deletions=0)
[]
# note that a deletion + insertion may be combined to match a substution
>>> find_near_matches('PATTERN', '---PAT-ERN---', max_deletions=1, max_insertions=1, max_substitutions=0)
[Match(start=3, end=10, dist=1)] # the Levenshtein distance is still 1
# ... but deletion + insertion may also match other, non-substitution differences
>>> find_near_matches('PATTERN', '---PATERRN---', max_deletions=1, max_insertions=1, max_substitutions=0)
[Match(start=3, end=10, dist=2)]
History
-------
0.6.1 (2018-12-08)
++++++++++++++++++
* Fixed some C compiler warnings for the C and Cython modules
0.6.0 (2018-12-07)
++++++++++++++++++
* Dropped support for Python versions 2.6, 3.2 and 3.3
* Added support and testing for Python 3.7
* Optimized the n-grams Levenshtein search for long sub-sequences
* Further optimized the n-grams Levenshtein search
* Cython versions of the optimized parts of the n-grams Levenshtein search
0.5.0 (2017-09-05)
++++++++++++++++++
* Fixed ``search_exact_byteslike()`` to support supplying start and end indexes
* Added support for lists, tuples and other Sequence types to ``search_exact()``
* Fixed a bug where ``find_near_matches()`` could return a wrong ``Match.end``
with ``max_l_dist=0``
* Added more tests and improved some existing ones.
0.4.0 (2017-07-06)
++++++++++++++++++
* Added support and testing for Python 3.5 and 3.6
* Many small improvements to README, setup.py and CI testing
0.3.0 (2015-02-12)
++++++++++++++++++
* Added C extensions for several search functions as well as internal functions
* Use C extensions if available, or pure-Python implementations otherwise
* setup.py attempts to build C extensions, but installs without if build fails
* Added ``--noexts`` setup.py option to avoid trying to build the C extensions
* Greatly improved testing and coverage
0.2.2 (2014-03-27)
++++++++++++++++++
* Added support for searching through BioPython Seq objects
* Added specialized search function allowing only subsitutions and insertions
* Fixed several bugs
0.2.1 (2014-03-14)
++++++++++++++++++
* Fixed major match grouping bug
0.2.0 (2013-03-13)
++++++++++++++++++
* New utility function ``find_near_matches()`` for easier use
* Additional documentation
0.1.0 (2013-11-12)
++++++++++++++++++
* Two working implementations
* Extensive test suite; all tests passing
* Full support for Python 2.6-2.7 and 3.1-3.3
* Bumped status from Pre-Alpha to Alpha
0.0.1 (2013-11-01)
++++++++++++++++++
* First release on PyPI.